20060629_pha4_b2

headersmall

EPIC home | Show all experiments for pha-4 | Back to previous page

Details for experimental series: 20060629_pha4_b2; gene: pha-4

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20060629_pha4_b2
Date	6/29/06
Person	JIM
Strain	RW10062
Treatments	None
Gene Assayed	pha-4
Type of Construct	Promoter Fusion
Imaged Timepoints	370
Edited Timepoints	200
Edited Cells	349
comments	8-40 % red laser D not lineaged
Edited By	JIM

return to top of series: 20060629_pha4_b2

Strain details:

Strain Name	RW10062
Date Created	19 07 2006 12:00:00
Source of Genotype	pha-4::H1-Wcherry
Reporter Allele	stIs10050
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::pha4_4.1kb
Created By	JIM

return to top of series: 20060629_pha4_b2

Construct details:

Plasmid Name	pJIM20::pha4_4.1kb
Gene	pha-4a
Transcript	F38A6.1a
Promoter Length	4100
Left Primer	ttagcccggggcccaaattttatgaccaaatga
Right Primer	tagcctaggtctcaaattagatagtccttcaaaaa
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20060629_pha4_b2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20060629_pha4_b2

return to top of series: 20060629_pha4_b2

Download annotations for this experiment

return to top of series: 20060629_pha4_b2