 |
|
EPIC home
|
Show all experiments for mir-57
|
Back to previous page
|
| Details for experimental series: 20060516_mir_57; gene: mir-57 |
| experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20060516_mir_57 |
Date |
5/2/07 |
Person |
zhao |
Strain |
RW10048 |
Treatments |
None |
Gene Assayed |
mir-57 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
366 |
Edited Timepoints |
266 |
Edited Cells |
450 |
comments
|
AVR 50->55 from t126 gain 1053 |
Edited By |
ZZ - partial |
return to top of series: 20060516_mir_57
|
Strain details:
Strain Name |
RW10048 |
Date Created |
06 01 2011 12:00:00 |
Source of Genotype |
Reporter Allele |
stIs10044 |
Lineage Allele |
|
Reporter Construct |
pJIM20::mir-57 |
Created By |
ZZ |
return to top of series: 20060516_mir_57
|
Construct details:
Plasmid Name |
pJIM20::mir-57 |
Gene |
mir-57 |
Transcript |
T09A5.13 |
Promoter Length |
2260 |
Left Primer |
aaaaatgttcccgattgtgtaaa |
Right Primer |
gagttcacatacctttttgaatatcat |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20060516_mir_57
|
Full size movie:
return to top of series: 20060516_mir_57
|
Fullsize tree:
return to top of series: 20060516_mir_57
|
View images
|
Download annotations for this experiment
return to top of series: 20060516_mir_57
|