Experiment Details Series 20090810_F32H2_6_b_L2 Date 2009-08-10 Person murray Treatments none Gene Assayed F32H2.6 Construct pJIM20::F32H2.6_1 Imaged Time Points 244 Edited Time Points 154 Edited Cells 356 Comments hyp; C to 190 EditedBy pete

Strain Details Strain Name RW11080 Date Created 2009-08-11 Source of Genotype stIs10874(F32H2.6::H1-Wcherry, DO NOT USE may be W10D9.4;unc-119(+));unc-119(ed3);stIs10024;zuIs178 Reporter Allele stIs10874 Reporter Construct pJIM20::F32H2.6_1 (Plasmid) Created By EAP/DKV

Construct Details Plasmid Name pJIM20::F32H2.6 Gene F32H2.6 Transcript F32H2.6 Promoter Length 2144 Left Primer gctctaaacacgttttttctccttttcg Right Primer ccaacgtttgggatccatgttatccg Vector pJIM20 Integrated,Expressing Strains 6