Experiment Details Series 20070523_egl5_sk Date 2007-05-23 Person murray Treatments none Gene Assayed egl-5 Construct pJIM20::C08C3.1a_1 Imaged Time Points 390 Edited Time Points 350 Edited Cells 351 Comments Expression primarily in C and D after 350 cells (edited to t250 EditedBy JIM

Strain Details Strain Name RW10115 Date Created 2007-05-14 Source of Genotype stIs10115(egl-5::H1-Wcherry;unc-119(+));unc-119(ed3) Reporter Allele stIs10115 Reporter Construct pJIM20::C08C3.1a_1 (Plasmid) Created By EAP/BLM/JIM

Construct Details Plasmid Name pJIM20::egl-5 Gene egl-5 Transcript C08C3.1a Promoter Length 6103 Left Primer tttttctcatctttctgctctgccc Right Primer tgtgtgtaccgtaatccctcactctcactgct Vector pJIM20 Integrated,Expressing Strains 1