20091118_T22C8_3_11_L1

headersmall

EPIC home | Show all experiments for T22C8.3 | Back to previous page

Details for experimental series: 20091118_T22C8_3_11_L1; gene: T22C8.3

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20091118_T22C8_3_11_L1
Date	11/18/09
Person	JIM
Strain	RW11142
Treatments	None
Gene Assayed	T22C8.3
Type of Construct	Promoter Fusion
Imaged Timepoints	259
Edited Timepoints	140
Edited Cells	363
comments	biased ubiq
Edited By	JIM

return to top of series: 20091118_T22C8_3_11_L1

Strain details:

Strain Name	RW11142
Date Created	30 10 2009 12:00:00
Source of Genotype	T22C8.3::H1-Wcherry
Reporter Allele	stIs10526
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::T22C8.3
Created By	EAP/DKV/JIM

return to top of series: 20091118_T22C8_3_11_L1

Construct details:

Plasmid Name	pJIM20::T22C8.3
Gene	T22C8.3
Transcript	T22C8.3
Promoter Length	2059
Left Primer	tattttgcttcctctatgacagttgcgt
Right Primer	ttgttcggtggttgccatgact
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20091118_T22C8_3_11_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20091118_T22C8_3_11_L1

return to top of series: 20091118_T22C8_3_11_L1

Download annotations for this experiment

return to top of series: 20091118_T22C8_3_11_L1