20090430_F21A10_2_9_L1

headersmall

EPIC home | Show all experiments for F21A10.2 | Back to previous page

Details for experimental series: 20090430_F21A10_2_9_L1; gene: F21A10.2

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20090430_F21A10_2_9_L1
Date	4/30/09
Person	JIM
Strain	RW10856
Treatments	None
Gene Assayed	F21A10.2
Type of Construct	Promoter Fusion
Imaged Timepoints	257
Edited Timepoints	160
Edited Cells	391
comments	broad; promoter a
Edited By	JIM

return to top of series: 20090430_F21A10_2_9_L1

Strain details:

Strain Name	RW10856
Date Created	23 02 2009 12:00:00
Source of Genotype	F21A10.2a::H1-Wcherry
Reporter Allele	stIs10654
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F21A10.2a
Created By	EAP/DKV/JIM

return to top of series: 20090430_F21A10_2_9_L1

Construct details:

Plasmid Name	pJIM20::F21A10.2a
Gene	F21A10.2a
Transcript	F21A10.2a
Promoter Length	5285
Left Primer	ctattttgagactgtgcgaaatttcgag
Right Primer	tcgaatattttgatccatatttccttgttcaaatgct
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20090430_F21A10_2_9_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20090430_F21A10_2_9_L1

return to top of series: 20090430_F21A10_2_9_L1

Download annotations for this experiment

return to top of series: 20090430_F21A10_2_9_L1