20081028_T23H4_2_5_L1

headersmall

EPIC home | Show all experiments for nhr-69 | Back to previous page

Details for experimental series: 20081028_T23H4_2_5_L1; gene: nhr-69

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081028_T23H4_2_5_L1
Date	10/29/08
Person	JIM
Strain	RW10762
Treatments	None
Gene Assayed	nhr-69
Type of Construct	Promoter Fusion
Imaged Timepoints	237
Edited Timepoints	137
Edited Cells	359
comments	E from E4, Chyp from C16, ABhyp from ~t160
Edited By	pete

return to top of series: 20081028_T23H4_2_5_L1

Strain details:

Strain Name	RW10762
Date Created	14 11 2008 12:00:00
Source of Genotype	T23H4.2::H1-Wcherry
Reporter Allele	stIs10656
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::T23H4.2
Created By	EAP/DKV/JIM

return to top of series: 20081028_T23H4_2_5_L1

Construct details:

Plasmid Name	pJIM20::T23H4.2
Gene	T23H4.2
Transcript	T23H4.2
Promoter Length	4644
Left Primer	aaccagaaaaaaagaatttcccacattg
Right Primer	acatatttcttcgaccatactttttgtctaaatatttatg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081028_T23H4_2_5_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081028_T23H4_2_5_L1

return to top of series: 20081028_T23H4_2_5_L1

Download annotations for this experiment

return to top of series: 20081028_T23H4_2_5_L1