20081024_mnm-2_7_L1

headersmall

EPIC home | Show all experiments for mnm-2 | Back to previous page

Details for experimental series: 20081024_mnm-2_7_L1; gene: mnm-2

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081024_mnm-2_7_L1
Date	10/24/08
Person	JIM
Strain	RW10722
Treatments	None
Gene Assayed	mnm-2
Type of Construct	Promoter Fusion
Imaged Timepoints	269
Edited Timepoints	110
Edited Cells	358
comments	ABpxaapa, pxaappa, ABarpapa, ABarpappa
Edited By	JIM

return to top of series: 20081024_mnm-2_7_L1

Strain details:

Strain Name	RW10722
Date Created	27 10 2008 12:00:00
Source of Genotype	mnm-2::H1-Wcherry
Reporter Allele	stIs10620
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::mnm-2
Created By	EAP/DKV/JIM

return to top of series: 20081024_mnm-2_7_L1

Construct details:

Plasmid Name	pJIM20::mnm-2
Gene	mnm-2
Transcript	C10A4.8
Promoter Length	5398
Left Primer	caactgagaaaggttagaaatgtgaccg
Right Primer	actagcttcgactgacatggctagt
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081024_mnm-2_7_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081024_mnm-2_7_L1

return to top of series: 20081024_mnm-2_7_L1

Download annotations for this experiment

return to top of series: 20081024_mnm-2_7_L1