20081024_K02G10_1_4_L2

headersmall

EPIC home | Show all experiments for K02G10.1 | Back to previous page

Details for experimental series: 20081024_K02G10_1_4_L2; gene: K02G10.1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081024_K02G10_1_4_L2
Date	10/24/08
Person	JIM
Strain	RW10723
Treatments	None
Gene Assayed	K02G10.1
Type of Construct	Promoter Fusion
Imaged Timepoints	249
Edited Timepoints	138
Edited Cells	359
comments	biased ubiq
Edited By	pete

return to top of series: 20081024_K02G10_1_4_L2

Strain details:

Strain Name	RW10723
Date Created	27 10 2008 12:00:00
Source of Genotype	K02G10.1::H1-Wcherry
Reporter Allele	stIs10523
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::K02G10.1
Created By	EAP/DKV/JIM

return to top of series: 20081024_K02G10_1_4_L2

Construct details:

Plasmid Name	pJIM20::K02G10.1
Gene	K02G10.1
Transcript	K02G10.1
Promoter Length	2121
Left Primer	ggatgttacggtaggccctgatattcta
Right Primer	aaccattgccaagcccatagatggttctgca
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081024_K02G10_1_4_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081024_K02G10_1_4_L2

return to top of series: 20081024_K02G10_1_4_L2

Download annotations for this experiment

return to top of series: 20081024_K02G10_1_4_L2