20081003_sma-9k_1_L2

headersmall

EPIC home | Show all experiments for sma-9 | Back to previous page

Details for experimental series: 20081003_sma-9k_1_L2; gene: sma-9

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081003_sma-9k_1_L2
Date	10/3/08
Person	JIM
Strain	RW10745
Treatments	None
Gene Assayed	sma-9
Type of Construct	Promoter Fusion
Imaged Timepoints	274
Edited Timepoints	160
Edited Cells	357
comments	hyp-biased ubiq (bias best after 350 cells)
Edited By	JIM

return to top of series: 20081003_sma-9k_1_L2

Strain details:

Strain Name	RW10745
Date Created	27 10 2008 12:00:00
Source of Genotype	sma-9k::H1-Wcherry
Reporter Allele	stIs10698
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::sma-9k
Created By	EAP/DKV/JIM

return to top of series: 20081003_sma-9k_1_L2

Construct details:

Plasmid Name	pJIM20::sma-9k
Gene	sma-9k
Transcript	T05A10.1k
Promoter Length	5410
Left Primer	ttgcatttagacatcattcctgttgatg
Right Primer	acccggagcaaatgccattggaggc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081003_sma-9k_1_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081003_sma-9k_1_L2

return to top of series: 20081003_sma-9k_1_L2

Download annotations for this experiment

return to top of series: 20081003_sma-9k_1_L2