20080905_dve-1_15_L1

headersmall

EPIC home | Show all experiments for dve-1 | Back to previous page

Details for experimental series: 20080905_dve-1_15_L1; gene: dve-1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080905_dve-1_15_L1
Date	9/5/08
Person	JIM
Strain	RW10611
Treatments	None
Gene Assayed	dve-1
Type of Construct	Promoter Fusion
Imaged Timepoints	251
Edited Timepoints	155
Edited Cells	358
comments	gut from E4; hyp late? (~t190), 3-fold symmetric trios in pharynx at end of series, 7-25
Edited By	JIM

return to top of series: 20080905_dve-1_15_L1

Strain details:

Strain Name	RW10611
Date Created	10 09 2008 12:00:00
Source of Genotype	dve-1::H1-Wcherry
Reporter Allele	stIs10692
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::dve-1
Created By	EAP/DKV/JIM

return to top of series: 20080905_dve-1_15_L1

Construct details:

Plasmid Name	pJIM20::dve-1
Gene	dve-1a
Transcript	ZK1193.5a
Promoter Length	5108
Left Primer	tgaatcacaacctccaatcactagtcaa
Right Primer	taccctcattgggaacatatctagctgaa
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080905_dve-1_15_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080905_dve-1_15_L1

return to top of series: 20080905_dve-1_15_L1

Download annotations for this experiment

return to top of series: 20080905_dve-1_15_L1