20080828_F38C2_7_12_L2

headersmall

EPIC home | Show all experiments for F38C2.7 | Back to previous page

Details for experimental series: 20080828_F38C2_7_12_L2; gene: F38C2.7

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080828_F38C2_7_12_L2
Date	8/28/08
Person	JIM
Strain	RW10615
Treatments	None
Gene Assayed	F38C2.7
Type of Construct	Promoter Fusion
Imaged Timepoints	274
Edited Timepoints	105
Edited Cells	184
comments	ubiquitous
Edited By	JIM

return to top of series: 20080828_F38C2_7_12_L2

Strain details:

Strain Name	RW10615
Date Created	10 09 2008 12:00:00
Source of Genotype	F38C2.7::H1-Wcherry
Reporter Allele	stIs10572
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F38C2.7
Created By	EAP/DKV/JIM

return to top of series: 20080828_F38C2_7_12_L2

Construct details:

Plasmid Name	pJIM20::F38C2.7
Gene	F38C2.7
Transcript	F38C2.7
Promoter Length	2385
Left Primer	tgtctggcagtcataagctctatcagtg
Right Primer	gcttgcttcaacagacattgtagaagttttg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080828_F38C2_7_12_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080828_F38C2_7_12_L2

return to top of series: 20080828_F38C2_7_12_L2

Download annotations for this experiment

return to top of series: 20080828_F38C2_7_12_L2