Experiment Details Series 20080909_T23G5_6_15_L1 Date 2008-09-09 Person murray Treatments none Gene Assayed saeg-2 Construct pJIM20::T23G5.6.1_1 Imaged Time Points 249 Edited Time Points 145 Edited Cells 357 Comments Brightest in ABarp/pla, E and C EditedBy JIM

Strain Details Strain Name RW10608 Date Created 2008-09-10 Source of Genotype stIs10683(T23G5.6::H1-Wcherry;unc-119(+));unc-119(ed3);stIs10024;zuIs178 Reporter Allele stIs10683 Reporter Construct pJIM20::T23G5.6.1_1 (Plasmid) Created By EAP/DKV/JIM

Construct Details Plasmid Name pJIM20::T23G5.6 Gene saeg-2 Transcript T23G5.6.1 Promoter Length 4328 Left Primer actcgtacgtaacttctgatccaacgaa Right Primer gagaatcactatcctcatattcattttgttgccattcccat Vector pJIM20 Integrated,Expressing Strains 4